View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_high_108 (Length: 201)
Name: NF18071_high_108
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_high_108 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 10 - 188
Target Start/End: Complemental strand, 38894594 - 38894416
Alignment:
| Q |
10 |
catcatcaaacaacctcagcaaacatgtcagcaacagctttgttgcaaaaagctgctcagattgggacaacttcaactgaatcattattccttggaagct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38894594 |
catcatcaaacaacctcagcaaacatgtcagcaacagctttgttgcaaaaagctgctcaaattgggacaacttcaactgaatcattattccttggaagct |
38894495 |
T |
 |
| Q |
110 |
taggtttgagatgcaatactccaagtcaagatcatgggaacaaattttgtggggtgtatggttcaagttcagttcttac |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38894494 |
taggtttgagatgcaatagtccaagtcaagatcatgggaacaaattttgtggggtgtatggttcaagttcagttcttac |
38894416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 3e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 13 - 124
Target Start/End: Complemental strand, 30516798 - 30516687
Alignment:
| Q |
13 |
catcaaacaacctcagcaaacatgtcagcaacagctttgttgcaaaaagctgctcagattgggacaacttcaactgaatcattattccttggaagcttag |
112 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||||| ||| |||||||||||| |||| |
|
|
| T |
30516798 |
catcaaacatcttcagcaaacatgtcagctacagctttgttacaaaaagctgctcaaattggatcaacttcaactgatacatcattccttggaagtttag |
30516699 |
T |
 |
| Q |
113 |
gtttgagatgca |
124 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
30516698 |
gtttgaaatgca |
30516687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University