View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_high_45 (Length: 344)
Name: NF18071_high_45
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_high_45 |
 | |
|
| [»] scaffold0130 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 9e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 166 - 326
Target Start/End: Complemental strand, 38908576 - 38908420
Alignment:
| Q |
166 |
atattgatgatctcactattataattcacttgtatacctttttaatttatggaccaatgaattttaagaatgagattaccaacataacaccctaatgcca |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
38908576 |
atattgatgatctcactattataattcacttgtatacctttttaatttgtggaccaatgaattttaagaatgagattaccaacataac-----aatgcaa |
38908482 |
T |
|
| Q |
266 |
cataagagaatacagattggatctttactcttaatacataaagagca-ccccaaattgggaa |
326 |
Q |
| |
|
||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
38908481 |
catcagagaatacagattggatctttactctttgtacataaagagcacccccaaattgggaa |
38908420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 61 - 101
Target Start/End: Complemental strand, 38908638 - 38908598
Alignment:
| Q |
61 |
tacaacatttctaacaatctgtgatatctgattcagaaaac |
101 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38908638 |
tacaacatttctaacaatctttgatatctgattcagaaaac |
38908598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0130 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: scaffold0130
Description:
Target: scaffold0130; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 21854 - 21780
Alignment:
| Q |
1 |
aaaatattggaaaactgaaattttggagacatgtcaaagcattaaaataataaagaaggttacaacatttctaac |
75 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21854 |
aaaatattggaaaactcaaattttggagacatgtcaaagcattaaaataataaagaaggttaaaacatttctaac |
21780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University