View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_high_62 (Length: 287)
Name: NF18071_high_62
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_high_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 63 - 277
Target Start/End: Complemental strand, 44733091 - 44732882
Alignment:
| Q |
63 |
gtagcttaatttgtaaggctaatgacatgcctttctaattttagacacaaaccaagttcttcttggttgtttagggtgatcaaagtctctcttattttga |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44733091 |
gtagcttaatttgtaaggctaatgacatgcctttctaattttagacacaaaccaagttcttcttggttgtttagggtgatcaaagtctctcttattttga |
44732992 |
T |
 |
| Q |
163 |
atttatcatgtaaatagtgccacttagctttacccttcttgcaggttgtttaagttttgaatgaaaagtgattaatcagtagaagcgagttgatagtttt |
262 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44732991 |
atttatcatgtaaatagtgcca-----ctttactcttcttgcaggttgtttaactttttaatgaaaagtgattaatcagtagaagcgagttgatagtttt |
44732897 |
T |
 |
| Q |
263 |
gtgttcactgttcat |
277 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44732896 |
gtgttcactgttcat |
44732882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University