View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_high_64 (Length: 273)
Name: NF18071_high_64
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_high_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 48818655 - 48818898
Alignment:
| Q |
18 |
cttgtttgatatgtagctatcagccaggaggaatgtggcggttcgagatttcaaagggatgacattggtttcaattagggagttctacactaaagatgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48818655 |
cttgtttgatatgtagctatcagccaggaggaatgtggcggttcgagatttcaaagggatgacattggtttcaattagggagttctacactaaagatgga |
48818754 |
T |
|
| Q |
118 |
aaacagcttcccactgctaaaggtgattgcttcggatacaatgtgttaatcttatacattggttttcgcttgaattattttctgctttgttacatcgtaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48818755 |
aaacagcttcccactgctaaaggtgattgcttcgtatacaatgtgttaatcttatacattggttttcgcttgaattattttctgctttgttacatcgtaa |
48818854 |
T |
|
| Q |
218 |
gtcttgcttgattttgatcgcaagtatttttaggacattattat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48818855 |
gtcttgcttgattttgatcgcaagtatttttagtacattattat |
48818898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University