View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_high_68 (Length: 265)
Name: NF18071_high_68
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_high_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 7 - 212
Target Start/End: Original strand, 30351909 - 30352110
Alignment:
| Q |
7 |
tgagaatttattctgtttttccagataataaagatgaaggtaccagatgctcaatttgtgaaatttccttattttgctgttacatttggttaattggcag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30351909 |
tgagaatttattctgtttttccagataataaagatgaaggtaccagatgctcaatttgtgaaatttccttattttgctgttacatttggttaattggcag |
30352008 |
T |
|
| Q |
107 |
ccacgtaaaggcttcaattaatttatttgtgaataatgaatgtagatgtatccttctgagggggtatatatagaaattaatttgttcagaaagaggacaa |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30352009 |
ccacgtaaagacttcaattaatttatttgtgaataatgaatatagatgtatcc----gagggggtatatatagaaattaatttgttcagaaagaggacaa |
30352104 |
T |
|
| Q |
207 |
aaagtt |
212 |
Q |
| |
|
|||||| |
|
|
| T |
30352105 |
aaagtt |
30352110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University