View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_high_79 (Length: 242)
Name: NF18071_high_79
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_high_79 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 47462263 - 47462057
Alignment:
| Q |
18 |
accaccatcctcctccttctctcggcccaaccgccccgttattgtcggatatatcgacaatacttcagacaatgattctctcaacgggtccaactcaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47462263 |
accaccatcctcctccttctctcggcccaaccggcccgttattgtcggatatatcgacaatacttcagacaatgattctctcaacgggtccaactcaaat |
47462164 |
T |
 |
| Q |
118 |
gatccaaaccatttttcttcatttttgtaatagtatatcaaatgcagtgtatgataactcataccatggtctacacccgtcaacttgtgggtcttacccg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47462163 |
gatccaaaccatttttcttcatttttgtaatagtatatcaaatgcagtgtatgataactcataccatggtctacacccgtcaacttgtggctcttacccg |
47462064 |
T |
 |
| Q |
218 |
aactcac |
224 |
Q |
| |
|
||||||| |
|
|
| T |
47462063 |
aactcac |
47462057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University