View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18071_high_81 (Length: 239)

Name: NF18071_high_81
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18071_high_81
NF18071_high_81
[»] chr1 (2 HSPs)
chr1 (19-239)||(4142016-4142227)
chr1 (203-239)||(4128506-4128542)


Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 4142016 - 4142227
Alignment:
19 accgacaatttagattgatggcatgtctgatgtccgacatgtaatagtgtttgccacttacttgacacgacagacacatattgttacactcaattacttt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||    
4142016 accgacaatttagattgatggcatgtctgatgtccgacatgtaatagtgtttg-----------acacgacagacacatattgttacactcaattacttt 4142104  T
119 atattttcttaaattt--atcagtgtctacttagtgccatgtcttgtgtctgtacttcgtaggagaaaactcatagcatgcatcgatttaattacgtacc 216  Q
    ||||||||||||||||  |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4142105 atattttcttaaatttttatcagtttctacttagtgtcatgtcttgtgtctgtacttcgtaggagaaaactcatagcatgcatcgatttaattacgtacc 4142204  T
217 tgagatgcagtgatacctattac 239  Q
    |||||||||||||||||||||||    
4142205 tgagatgcagtgatacctattac 4142227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 239
Target Start/End: Original strand, 4128506 - 4128542
Alignment:
203 tttaattacgtacctgagatgcagtgatacctattac 239  Q
    |||||||||||||||| ||||||||||||||| ||||    
4128506 tttaattacgtacctgtgatgcagtgataccttttac 4128542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University