View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_high_86 (Length: 236)
Name: NF18071_high_86
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_high_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 12 - 133
Target Start/End: Complemental strand, 38862025 - 38861903
Alignment:
| Q |
12 |
cacagattagtcaggtttggcatgcttcctaatactgatttcggtaccaaactcaatcctaccnnnnnnn-ttataggttttggaatgacataaaatcaa |
110 |
Q |
| |
|
||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38862025 |
cacagattagtcatgtttggtatgcttcttaatactgatttcggtaccaaactcaatcctaccaaaaaaaattataggttttggaatgacataaaatcaa |
38861926 |
T |
 |
| Q |
111 |
ttatcaaattttcattaatgtat |
133 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38861925 |
ttatcaaattttcattaatgtat |
38861903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University