View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_high_90 (Length: 233)
Name: NF18071_high_90
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_high_90 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 32639873 - 32639997
Alignment:
| Q |
1 |
aaaggctcataagctagacggataatatgaatgaactcattcttcaactccacgaaagttatacatggagttactgacatttcaaatggccgtatccgtt |
100 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32639873 |
aaaggctcataagctagacgaaaaatatgaatgaactcattcttcaactccactaaagtcatacatggagttactgacatttcaaatggtcgtatccgtt |
32639972 |
T |
 |
| Q |
101 |
gatcaaatttaacagtggccaatct |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32639973 |
gatcaaatttaacagtggccaatct |
32639997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 12 - 125
Target Start/End: Complemental strand, 32635610 - 32635497
Alignment:
| Q |
12 |
agctagacggataatatgaatgaactcattcttcaactccacgaaagttatacatggagttactgacatttcaaatggccgtatccgttgatcaaattta |
111 |
Q |
| |
|
||||||||| | ||||||| ||||||| |||||||| ||| ||||| ||||||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
32635610 |
agctagacgaaaaatatgattgaactcgttcttcaatgtcactaaagtcatacatggagttactgacatttcaaattgccatatcccatgatcaaattta |
32635511 |
T |
 |
| Q |
112 |
acagtggccaatct |
125 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
32635510 |
acagtggacaatct |
32635497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University