View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_100 (Length: 226)
Name: NF18071_low_100
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_100 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 303622 - 303846
Alignment:
| Q |
1 |
acttttccttaaccattaaatctgaagaggactctcaagatagttgcaagactaattccacccctggtgctagaggatctcacaaaagaaggtactaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303622 |
acttttccttaaccattaaatctgaagaggactctcaagatagttgcaagactaattccacccctggtgctagaggatctcacaaaagaaggtactaatc |
303721 |
T |
 |
| Q |
101 |
attaaaaacaatcatgttaattgtttgctagctaggaatatgaaca--------------nnnnnnngttaatttgcagaaaaactagagaaacgtgtga |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
303722 |
attaaaaacaatcatgttaattgtttgctagctaggaatatgaacatttttttatttattgatcatggttaatttgcagaaaaactagagaaacgtgtga |
303821 |
T |
 |
| Q |
187 |
ggaagtgtcagaaagaccaacagat |
211 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
303822 |
ggaagtgtcagaaagaccaacagat |
303846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University