View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_112 (Length: 208)
Name: NF18071_low_112
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_112 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 2e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 14 - 162
Target Start/End: Complemental strand, 32551157 - 32551008
Alignment:
| Q |
14 |
aagaagatgata-taccggaattaatgagttttttacatagcttgtttctcccacaccacccttcatacgaagaactcgctccattaattgctatgaaaa |
112 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32551157 |
aagaagatgataataccggaattaatgagttatttacatagcttgtttctcccacaccacccttcatacgaagaactcgctccattaattgctatgaaaa |
32551058 |
T |
 |
| Q |
113 |
agaccacaactatatgtaatgaatgatgaggcaagtgaagtggtacatat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32551057 |
agaccacaactatatgtaatgaatgatgaggcaagtgaagtggtacatat |
32551008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 79
Target Start/End: Original strand, 32651240 - 32651280
Alignment:
| Q |
39 |
gagttttttacatagcttgtttctcccacaccacccttcat |
79 |
Q |
| |
|
||||| ||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
32651240 |
gagttattttcatagcttgtttcccccacaccacccttcat |
32651280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University