View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18071_low_112 (Length: 208)

Name: NF18071_low_112
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18071_low_112
NF18071_low_112
[»] chr7 (2 HSPs)
chr7 (14-162)||(32551008-32551157)
chr7 (39-79)||(32651240-32651280)


Alignment Details
Target: chr7 (Bit Score: 138; Significance: 2e-72; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 14 - 162
Target Start/End: Complemental strand, 32551157 - 32551008
Alignment:
14 aagaagatgata-taccggaattaatgagttttttacatagcttgtttctcccacaccacccttcatacgaagaactcgctccattaattgctatgaaaa 112  Q
    |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32551157 aagaagatgataataccggaattaatgagttatttacatagcttgtttctcccacaccacccttcatacgaagaactcgctccattaattgctatgaaaa 32551058  T
113 agaccacaactatatgtaatgaatgatgaggcaagtgaagtggtacatat 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
32551057 agaccacaactatatgtaatgaatgatgaggcaagtgaagtggtacatat 32551008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 79
Target Start/End: Original strand, 32651240 - 32651280
Alignment:
39 gagttttttacatagcttgtttctcccacaccacccttcat 79  Q
    ||||| ||| ||||||||||||| |||||||||||||||||    
32651240 gagttattttcatagcttgtttcccccacaccacccttcat 32651280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University