View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_35 (Length: 397)
Name: NF18071_low_35
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 223 - 295
Target Start/End: Original strand, 10834729 - 10834801
Alignment:
| Q |
223 |
cttgttgaactttattgcattagtaggaaaacattatgaaaaggaagttaaaatgatttgaagtgacgatgga |
295 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
10834729 |
cttgttgaactttattgcattagtaggaagacagtatgaaaaggaagttaaaatgattcgaagtgacaatgga |
10834801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 224 - 264
Target Start/End: Original strand, 14801920 - 14801960
Alignment:
| Q |
224 |
ttgttgaactttattgcattagtaggaaaacattatgaaaa |
264 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| |||||||| |
|
|
| T |
14801920 |
ttgttgaattttattgcattagtagaaaaacaatatgaaaa |
14801960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 224 - 264
Target Start/End: Original strand, 14810794 - 14810834
Alignment:
| Q |
224 |
ttgttgaactttattgcattagtaggaaaacattatgaaaa |
264 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| |||||||| |
|
|
| T |
14810794 |
ttgttgaattttattgcattagtagaaaaacaatatgaaaa |
14810834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University