View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_69 (Length: 267)
Name: NF18071_low_69
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_69 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 53007064 - 53006798
Alignment:
| Q |
1 |
caggatcaacaagtcagtcattctctactttaagatcaacgagccaatcaccgataacataatatgataatggttagatgttgtaggtaaattttctcgt |
100 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53007064 |
caggatcaacgagtcagttattctctactttaagatcaacgagtcaatcaccgacaatataatatgataatggttagatgttgtaggtaaattttctcgt |
53006965 |
T |
 |
| Q |
101 |
aaaaagttttagggaacccgtgatgtcgagaatcggtcactagacctacaatgtaaaattgtaagggtcatgattgatacgttactatatatctctattt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
53006964 |
aaaaagttttagggaacccatgatgtcgagaatcggtcactaaacctataatgtaaaattgtaagagtcatgattgacacgttactatatatctctattt |
53006865 |
T |
 |
| Q |
201 |
aagatctcattttcaagtttggatgagcaatggcttttgcaaaatcacaatgaagctgtgatttttt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
53006864 |
aagatctcattttcaagtttggatgagcaatggattttgcaaaatcacactgacgctgtgatttttt |
53006798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University