View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_72 (Length: 257)
Name: NF18071_low_72
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_72 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 9463407 - 9463215
Alignment:
| Q |
17 |
aaaagaatgaaccttcaatcaacaacactgataatcaagctttgttgaaacaagttgctttgaccgatatgctcggtgattggaaagacggaattcttac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9463407 |
aaaagaatgaaccttcaatcaacaacactgataatcaagctttgttgaaacaagttgctttgaccgatatgctcggtgattggaaagacggaattcttac |
9463308 |
T |
|
| Q |
117 |
cattggtactcttggctatgatcctttgaaatccatgaacaatcacaaagaatactttgctttggaagctgaaaaacaacatgatttagttgt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9463307 |
cattggtactcttggctatgatcctttgaaatccatgaacaatcacaaagaatactttgctttggaagctgaaaaacaacatgatatagttgt |
9463215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University