View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_80 (Length: 243)
Name: NF18071_low_80
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_80 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 55 - 238
Target Start/End: Complemental strand, 39636928 - 39636747
Alignment:
| Q |
55 |
cagatccacttagattatagtcaagtggtttgactcaattggctaataaatttgaaatagtagttaaaatgcctcttttgtttttcttcccaaatccctt |
154 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39636928 |
cagatccacttagactataatcaagtggtttgattcaattggctaataaatttgaaatagtagttaaaatgcctctt--gtttttcttcccaaatccctt |
39636831 |
T |
|
| Q |
155 |
ctctcccctccctacgcttccaaacggagcctaaattatcaaattgatagtgtattgtgtgttttagtacttttgtttaatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39636830 |
ctctcccctccctacgcttccaaacggagcctaaattatcaaattgatagtgtattgtgtgttttagtacttttgtttaatatt |
39636747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 39640488 - 39640428
Alignment:
| Q |
1 |
ctataagcactataccaaagtttgtcgttattgtttacaatttgattaacatatcagatcc |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39640488 |
ctataagcactataccaaagtttgtcgttattgtttacaatttgattaacatatcatatcc |
39640428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University