View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_81 (Length: 243)
Name: NF18071_low_81
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_81 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 13397644 - 13397854
Alignment:
| Q |
18 |
tcaattaaatagttttgatgatgttcatttcttgaattaattagattatgtttttgtttagttgtagcttagttaccattgtaagacattcgtagatcgt |
117 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| | |
|
|
| T |
13397644 |
tcaattaaatagttctgatgatgttcacttgttgaattaattagattatgtttttgtttagttgtaacttggttaccattgtaagacattcgtagatcat |
13397743 |
T |
 |
| Q |
118 |
tgtagaaacaagtttagttgtcatctcttttcagaatctcatatctcaagttttgattcgattcaaaattggtatacattctttgaatcgaagcactttt |
217 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13397744 |
tgtagcaacaagtttggttgtcatctcttttcagaatctcatatctcaagttttgattctattcaaaattggtatacattctttgaatcgaagcattttt |
13397843 |
T |
 |
| Q |
218 |
ctatccctatg |
228 |
Q |
| |
|
|||||| |||| |
|
|
| T |
13397844 |
ctatccttatg |
13397854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 99
Target Start/End: Complemental strand, 15784274 - 15784200
Alignment:
| Q |
25 |
aatagttttgatgatgttcatttcttgaattaattagattatgtttttgtttagttgtagcttagttaccattgt |
99 |
Q |
| |
|
|||||||||||||||||| | ||||| || |||||| ||||||||||||| ||| | ||||||||||||||| |
|
|
| T |
15784274 |
aatagttttgatgatgttttctccttgatttgtttagataatgtttttgtttaattgcaacttagttaccattgt |
15784200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University