View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_83 (Length: 242)
Name: NF18071_low_83
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_83 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 40189369 - 40189156
Alignment:
| Q |
14 |
tatactcaaggttgtgacaacatgctatatgacatttatgccctatagttatagttgttcctataaatacattacttttattgcaagcgtaaccatttta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40189369 |
tatactcaaggttgtgacaacatgctatatgacatttataccctatagttatagttgttccaataaatacattacttttattgcaagcgtaaccatttta |
40189270 |
T |
|
| Q |
114 |
atgtaatcctatatcaacaaggacaaaaaacatgaaaaaccccacatggataaaggattagttgcagatagagacgacccgaatctaaagagtagttgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40189269 |
atgtaatcctatatcaacaaggacaaaaaacatgaaaaaccccacatggataaaggattagttgcagatagagacgacccgaatctaaagagtagttgtt |
40189170 |
T |
|
| Q |
214 |
aattggaatctagt |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40189169 |
aattggaatctagt |
40189156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University