View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_85 (Length: 239)
Name: NF18071_low_85
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_85 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 4142016 - 4142227
Alignment:
| Q |
19 |
accgacaatttagattgatggcatgtctgatgtccgacatgtaatagtgtttgccacttacttgacacgacagacacatattgttacactcaattacttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142016 |
accgacaatttagattgatggcatgtctgatgtccgacatgtaatagtgtttg-----------acacgacagacacatattgttacactcaattacttt |
4142104 |
T |
 |
| Q |
119 |
atattttcttaaattt--atcagtgtctacttagtgccatgtcttgtgtctgtacttcgtaggagaaaactcatagcatgcatcgatttaattacgtacc |
216 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142105 |
atattttcttaaatttttatcagtttctacttagtgtcatgtcttgtgtctgtacttcgtaggagaaaactcatagcatgcatcgatttaattacgtacc |
4142204 |
T |
 |
| Q |
217 |
tgagatgcagtgatacctattac |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4142205 |
tgagatgcagtgatacctattac |
4142227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 239
Target Start/End: Original strand, 4128506 - 4128542
Alignment:
| Q |
203 |
tttaattacgtacctgagatgcagtgatacctattac |
239 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
4128506 |
tttaattacgtacctgtgatgcagtgataccttttac |
4128542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University