View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_93 (Length: 234)
Name: NF18071_low_93
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_93 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 118 - 220
Target Start/End: Original strand, 36204286 - 36204388
Alignment:
| Q |
118 |
tgtggttgctatgtaatccttcttgccctttctggtcatgattgtgttttgtacaatgcatgcatgtgatcaattgttaaaggatgttttggtatagaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36204286 |
tgtggttgctatgtaatccttcttgccctttctggtcatgattgtgttttgtacaatgcatgcatgtgatcaattgttaaaggatgttttggtatagaat |
36204385 |
T |
 |
| Q |
218 |
tat |
220 |
Q |
| |
|
||| |
|
|
| T |
36204386 |
tat |
36204388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 36204165 - 36204266
Alignment:
| Q |
20 |
ggttctacttctaccaaagaaggagagaatctttcttttcctcctgaatcatattttagtcatgaggtacttatttttccttgtttaatgtccagctttg |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36204165 |
ggttctacttctaccaaag---gagagaatctttcttttcctcctgaatcatattttagtcatgaggtacttgtttttccttgtttaatgtccagctttg |
36204261 |
T |
 |
| Q |
120 |
tggtt |
124 |
Q |
| |
|
||||| |
|
|
| T |
36204262 |
tggtt |
36204266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 215
Target Start/End: Complemental strand, 11068504 - 11068470
Alignment:
| Q |
181 |
atgtgatcaattgttaaaggatgttttggtataga |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11068504 |
atgtgatcaattgttaaagaatgttttggtataga |
11068470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University