View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18071_low_97 (Length: 228)
Name: NF18071_low_97
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18071_low_97 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 12 - 215
Target Start/End: Original strand, 10241899 - 10242103
Alignment:
| Q |
12 |
agaacctgtgacttcacatgctcgcaaacgaagggacaatcgatgtccacatgcttgatgcgttcatgacttataggattgagtt-gagatttgctatcg |
110 |
Q |
| |
|
|||| ||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
10241899 |
agaaactgagacttcacatgctcgcaaatgaagggacaatcgatgtccacatgcttgatgcgttcatgacttataggatcgagtttgagatttgctatcg |
10241998 |
T |
 |
| Q |
111 |
caatacgtcatgaccgaagacatgggaccttaaaaactcgaagaatgagaaagattgggctgtttcttagatttccatgatatctaggtttagattggtt |
210 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10241999 |
caaaatgtcatgaccgaagacatgggaccttaaaaactcgaagaatgagaaagattgggctgtttcttagatttccatgatatctaggtttagattggtt |
10242098 |
T |
 |
| Q |
211 |
tttat |
215 |
Q |
| |
|
||||| |
|
|
| T |
10242099 |
tttat |
10242103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 10266235 - 10266297
Alignment:
| Q |
22 |
acttcacatgctcgcaaacgaagggacaatcgatgtccacatgcttgatgcgttcatgactta |
84 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||| |||||||||| | | |||||||||||| |
|
|
| T |
10266235 |
acttcacattctcacaaatgaagggacaatcgatttccacatgctaggagagttcatgactta |
10266297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University