View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18072_high_24 (Length: 211)

Name: NF18072_high_24
Description: NF18072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18072_high_24
NF18072_high_24
[»] chr3 (1 HSPs)
chr3 (20-144)||(28852260-28852384)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 20 - 144
Target Start/End: Original strand, 28852260 - 28852384
Alignment:
20 gatggatacatcatattcaactttccttgaatcgtccctaatatacagactaatactttgcaaagtgacatcaagtgaatccatgcgtgaattgaaatat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28852260 gatggatacatcatattcaactttccttgaatcgtccctaatatacagactaatactttgcaaagtgacatcaagtgaatccatgcgtgaattgaaatat 28852359  T
120 gcattagttagacgcaatgtgcatg 144  Q
    ||||||||||||||||||| |||||    
28852360 gcattagttagacgcaatgcgcatg 28852384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University