View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18072_high_9 (Length: 389)
Name: NF18072_high_9
Description: NF18072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18072_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 1 - 374
Target Start/End: Original strand, 45403125 - 45403498
Alignment:
| Q |
1 |
ctcacttcatacttttgacctatgttgttgtcgttatcatcactctcactctccatggttgaatcaaaaagtcttcggcccttcaattttcctctctcaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403125 |
ctcacttcataattttgacctatgttgttgtcgttatcatcactctcactctccatggttgaatcaaaaagtcttcggcccttcaattttcctctctcaa |
45403224 |
T |
|
| Q |
101 |
tagcttctctacgttcttggagagtctctctagctgccacatcatgattcttccatgtttcttcttctgatgatgaagaatctctttgaagactaaacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403225 |
tagcttctctacgttcttggagagtctctctagctgccacatcatgattcttccatgtttcttcttctgatgatgaagaatctctttgaagactaaacat |
45403324 |
T |
|
| Q |
201 |
gagttctctaggagaaataatgctgttattaatttctagccctaggttttgaaaaataggttttgtggcgatgtttaaaggagaacgatattttcgtgaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45403325 |
gagttctctaggagaaataatgctgttattaatttctagccctaggttttgaaaaataggttttgtggcgatgtttaaaggggaacgatattttcgtgaa |
45403424 |
T |
|
| Q |
301 |
gttgttgatcttgattccttaaacgcgttccaatcttgttctagtttcttgtatttctgatgaagttctcttgt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403425 |
gttgttgatcttgattccttaaacgcgttccaatcttgttctagtttcttgtatttctgatgaagttctcttgt |
45403498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University