View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18072_low_16 (Length: 332)
Name: NF18072_low_16
Description: NF18072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18072_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 308; Significance: 1e-173; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 30091777 - 30091462
Alignment:
| Q |
1 |
atgtacaaagtcatttgggaagagggtcttttggcttctgatgttttagctggaatggaccaagctattgctgatggtgttgatgtgatttcaatttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30091777 |
atgtacaaagtcatttgggaagagggtcttttggcttctgatgttttagctggaatggaccaagctattgctgatggtgttgatgtgatttcaatttcta |
30091678 |
T |
 |
| Q |
101 |
tgggattcgatggtgttccactttatgaagatgctatagcaatagcttcttttgcagctatggagaaagggattgttgtttcgtcttctgcaggtaactc |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30091677 |
tgggatttgatggtgttccactttatgaagatgctatagcaatagcttcttttgcagctatggagaaagggattgttgtttcgtcttctgcaggtaactc |
30091578 |
T |
 |
| Q |
201 |
aggaccgaagcatggaactttgcacaatggtatcccttgggttcttactgtagctgcaggaaccatagatagaacttttggcagccttgttttggggaat |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30091577 |
aggacctaagcatggaactttgcacaatggtatcccttgggttcttactgtagctgcaggaaccatagatagaacttttggcagccttgttttggggaat |
30091478 |
T |
 |
| Q |
301 |
ggtcaaaacattattg |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30091477 |
ggtcaaaacattattg |
30091462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 30087797 - 30087482
Alignment:
| Q |
1 |
atgtacaaagtcatttgggaagagggtcttttggcttctgatgttttagctggaatggaccaagctattgctgatggtgttgatgtgatttcaatttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
30087797 |
atgtacaaagtcatttgggaagaggatgttatggcttctgatgttttagctggaatggaccaagcaattattgatggtgttgacgtgatttcaatttcta |
30087698 |
T |
 |
| Q |
101 |
tgggattcgatggtgttccactttatgaagatgctatagcaatagcttcttttgcagctatggagaaagggattgttgtttcgtcttctgcaggtaactc |
200 |
Q |
| |
|
| ||| | |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30087697 |
ttggaattgatggtattccactttatgaagatgctatagcaatagcttcttttacagctatggagaaagggattgttgtttcatcttctgcaggtaactc |
30087598 |
T |
 |
| Q |
201 |
aggaccgaagcatggaactttgcacaatggtatcccttgggttcttactgtagctgcaggaaccatagatagaacttttggcagccttgttttggggaat |
300 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
30087597 |
aggacctaagcatggaaccttgcacaatggtatcccttgggtccttactgtagctgcaggaaccacagatagaacttttggcagccttgttttgggaaat |
30087498 |
T |
 |
| Q |
301 |
ggtcaaaacattattg |
316 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
30087497 |
ggtgaaaacattattg |
30087482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 30099136 - 30099451
Alignment:
| Q |
1 |
atgtacaaagtcatttgggaagagggtcttttggcttctgatgttttagctggaatggaccaagctattgctgatggtgttgatgtgatttcaatttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| || ||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||| | |
|
|
| T |
30099136 |
atgtacaaagtcatttgggaagagggtcgtttcgcctctgatgttttagctggcatggaccaagctattaacgacggtgttgatgtgatttcaatttcaa |
30099235 |
T |
 |
| Q |
101 |
tgggattcgatggtgttccactttatgaagatgctatagcaatagcttcttttgcagctatggagaaagggattgttgtttcgtcttctgcaggtaactc |
200 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||| | |
|
|
| T |
30099236 |
tgggatttgatgatgttccactttatgaagatcctatagcaatagcttcatttgcagctatggaaaaagggattgttgtttcatcttctgcaggtaacgc |
30099335 |
T |
 |
| Q |
201 |
aggaccgaagcatggaactttgcacaatggtatcccttgggttcttactgtagctgcaggaaccatagatagaacttttggcagccttgttttggggaat |
300 |
Q |
| |
|
|||||| | ||||| ||||||||||||||||| ||| | ||||||| |||||||||||| ||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
30099336 |
aggacctgaattcggaaccttgcacaatggtatcccatggctccttactgcagctgcaggaacaatagatagaacttttggcactcttgttttgggaaat |
30099435 |
T |
 |
| Q |
301 |
ggtcaaaacattattg |
316 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
30099436 |
ggtcaaagcattattg |
30099451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 35171497 - 35171334
Alignment:
| Q |
1 |
atgtacaaagtcatttgggaagagggtcttttggcttctgatgttttagctggaatggaccaagctattgctgatggtgttgatgtgatttcaatttcta |
100 |
Q |
| |
|
||||| ||||| ||||||| || |||| | | |||||||||||| | || |||||||| |||||||||| |||| ||||||||| || ||||| || |
|
|
| T |
35171497 |
atgtataaagtactttgggacgaaggtcgtctagcttctgatgttcttgcaggaatggatcaagctattgatgataatgttgatgttatctcaatctcat |
35171398 |
T |
 |
| Q |
101 |
tgggattcgatggtgttccactttatgaagatgctatagcaatagcttcttttgcagctatgga |
164 |
Q |
| |
|
| || || || |||||||||||||||||||| | | ||||||||||| |||||||| ||||| |
|
|
| T |
35171397 |
taggttttaatagtgttccactttatgaagatccagttgcaatagcttcatttgcagcaatgga |
35171334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 197
Target Start/End: Complemental strand, 8946639 - 8946567
Alignment:
| Q |
125 |
atgaagatgctatagcaatagcttcttttgcagctatggagaaagggattgttgtttcgtcttctgcaggtaa |
197 |
Q |
| |
|
|||||||| | || |||||||| ||||||||||||||||| ||||| ||| |||| || | ||| |||||||| |
|
|
| T |
8946639 |
atgaagatccgattgcaatagcctcttttgcagctatggaaaaaggtatttttgtgtcttgttcagcaggtaa |
8946567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University