View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18072_low_22 (Length: 262)
Name: NF18072_low_22
Description: NF18072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18072_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 20 - 112
Target Start/End: Complemental strand, 46504027 - 46503935
Alignment:
| Q |
20 |
accctgaccttgacaagatgagttatttctttcttttgagaatgggagaaaagctccaccatttctatgtttaggactaatgttaaatccaat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46504027 |
accctgaccttgacaagatgagttatttctttcttttgagaatgggagaaaagctccaccatttctatgtttaggactaatgttaaatccaat |
46503935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 182 - 257
Target Start/End: Complemental strand, 46503865 - 46503790
Alignment:
| Q |
182 |
gctccataattgtgcacttgtcatccaatttgccatatcacatacattattatttgttgtcttttcctatgcttct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
46503865 |
gctccataattgtgcacttgtcatccaatttgccatatcacatacattattatttgttgtcttttccaatgtttct |
46503790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University