View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18073_high_7 (Length: 239)
Name: NF18073_high_7
Description: NF18073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18073_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 13 - 150
Target Start/End: Complemental strand, 26015851 - 26015714
Alignment:
| Q |
13 |
aatatacgactcacatgccatccgttctttccttgttaaattacataccgtcaattcaccattagcaaacatagcattagcaatggcaaacaacatcccc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26015851 |
aatatacgactcacatgccatccgttcttttcttgttaaattacataccgtcaattcaccattagcaaacatggcattagcaatggcaaacaacatcccc |
26015752 |
T |
 |
| Q |
113 |
acaatcataactttgttgcatgcttccatctctatata |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26015751 |
acaatcataactttgttgcatgcttccatctctatata |
26015714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 150 - 222
Target Start/End: Complemental strand, 26015634 - 26015562
Alignment:
| Q |
150 |
aaattgaacattgtcgcaatagtcaataaaatttaatttagtggtgtttaatggccaattgtaaatatcattg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26015634 |
aaattgaacattgtcgcaatagtcaataaaatttaatttagtggtgtttaatggccaattgtaaatatcattg |
26015562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University