View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18073_low_4 (Length: 294)
Name: NF18073_low_4
Description: NF18073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18073_low_4 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 294
Target Start/End: Complemental strand, 34674902 - 34674624
Alignment:
| Q |
16 |
gttgtttcaaaagttatcaaaaaatggtcatacaactacgcgttaaaagcttttgacatgaaatttacctttatgcgatcatcctatgtggccattcttc |
115 |
Q |
| |
|
||||||| ||||||| || |||| |||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34674902 |
gttgttttaaaagttgtcgaaaagtggttgtacaactacgcgttaaaagcttctgacatgaaatttacctttatgagatcatcctatgtggccattcttc |
34674803 |
T |
 |
| Q |
116 |
tcatcctatgtagcatttctctttaagaaatttaattccaactccttaactttcaagcacttttcctcaaaagnnnnnnnnntcaaggattatatttgag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34674802 |
tcatcctatgtagcatttctctttaagaaatttaattccaactccttaactttcaagcacttttcctcaaaagaaaaaaaaatcaaggattatatttgag |
34674703 |
T |
 |
| Q |
216 |
tcctttattattcagcaaaatttacatttcgcgtagctattttctgtcattttaattcttttttgaaaaattcaagtcc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
34674702 |
tcctttattattcagcaaaatttacatttcgcgtagctattttctatcattttaaatcttttttgaaaaattcaagtcc |
34674624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 59 - 118
Target Start/End: Complemental strand, 34652007 - 34651946
Alignment:
| Q |
59 |
taaaagcttttgacatgaaatttacctttatgcgatcatccta--tgtggccattcttctca |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
34652007 |
taaaagcttttgacatgacatttacctttataccgtcatcctatgtgtggccattcttctca |
34651946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University