View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18074_high_5 (Length: 359)
Name: NF18074_high_5
Description: NF18074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18074_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 17 - 302
Target Start/End: Original strand, 4146872 - 4147157
Alignment:
| Q |
17 |
aacttggagttggaaacacatgatgcgtttttccttagttagtctaattattattattgtttagctttgcttattttgttgaatgatgacttacttagtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4146872 |
aacttggagttggaaacacatgatgcgtttttccttagttagtctaattattattattgtttagctttgcttattttgttgaatgatgacttacttagtc |
4146971 |
T |
 |
| Q |
117 |
ttcgacaaatcttgtactctcttttgcttttcttatcaacgaaagagaaacatataatttataaggtgccagaatattatttgcatcaggttattttggt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4146972 |
ttcgacaaatcttgtactctcttttgcttttcttatcaacgaaagagaaacatataatttataaggtgccagattgttatttgcatcaggttattttggt |
4147071 |
T |
 |
| Q |
217 |
agtcttgatctgagtttggaatttctttttgatatttttatttatttatctgaagtacacaagtgttatattcaccatcactcttg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4147072 |
agtcttgatctgagtttggaatttctttttgatatttttatttatttatctgaagtacacaagtgttatattcaccatcactcttg |
4147157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 76 - 150
Target Start/End: Complemental strand, 46671729 - 46671654
Alignment:
| Q |
76 |
tttagctttgcttattttgttgaatgatgacttacttagtcttc-gacaaatcttgtactctcttttgcttttctt |
150 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| | |||| |||||||||||| |||||| || |||||||| |
|
|
| T |
46671729 |
tttagctttgcttattatggggaatgatgacttacttcgacttcagacaaatcttgtgctctctgttacttttctt |
46671654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University