View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18074_low_9 (Length: 210)
Name: NF18074_low_9
Description: NF18074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18074_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 23 - 201
Target Start/End: Original strand, 7222883 - 7223056
Alignment:
| Q |
23 |
taaggttagaagtgaaccttcttgcaagtagattagcttagaaattgatttaaaagacatagtgcatgtttggagggagggagagtcaaaaattgatttt |
122 |
Q |
| |
|
|||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
7222883 |
taaggttagaagggaaccttcttgcgactagattagcttagaaattgatttaaaagacatagtgcatgtttggagggag----agtcaaaa-ttgatttt |
7222977 |
T |
 |
| Q |
123 |
aaagacttaaaattgatatatttaggggttcttgattcaaattgatttgtcttaagaaccgatttaacttgaacctatg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
7222978 |
aaagacttaaaattgatatatttaggggttgttgattcaaattgatttatcttaagaaccaatttaacttgaacctatg |
7223056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University