View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18075_low_7 (Length: 362)
Name: NF18075_low_7
Description: NF18075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18075_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 286; Significance: 1e-160; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 13 - 341
Target Start/End: Original strand, 4818826 - 4819161
Alignment:
| Q |
13 |
atactcggtttgcgaaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctttgtaacctgggttctagtatactcaaatgcgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4818826 |
atactcggtttgcgaaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctttgtaacctgggttctagtatactcaaatgcgc |
4818925 |
T |
|
| Q |
113 |
tttattaccgagtagccctttacacacgtcagtagccagcagcgcccttgtatcactggtatattttcttgaatgcaaatcctaaagcaactatcttctt |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4818926 |
tttattaccgagtagcccttaacacacgtcagtagccagcagcgcccttgtatcactggtatcttttcttgaaggaaaatcctaaagcaactatcttctt |
4819025 |
T |
|
| Q |
213 |
gttagaaaatttgttaggcattgatggga-------ccagggaccacattgttcatgaaccgactcttctgataatcgttgatcttgataacttttttct |
305 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4819026 |
gttagaaaatttgttaggcattgatgggaccagggtccagggaccacattgttcgtgaaccgactcttctgataatcgttgatcttgataacttgtttct |
4819125 |
T |
|
| Q |
306 |
aatattcagaaacttcaaataaaccattatacacgc |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4819126 |
aatattcagaaacttcaaataaaccattatacacgc |
4819161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 4845208 - 4845260
Alignment:
| Q |
27 |
aaaaaatacttggctaaatttattcatccacaaatccctttgtatttgatcctt |
80 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
4845208 |
aaaaaatacttggctaa-ttgattcatccacaaatccctttgtatttgatcctt |
4845260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 321
Target Start/End: Original strand, 4806155 - 4806207
Alignment:
| Q |
269 |
ctcttctgataatcgttgatcttgataacttttttctaatattcagaaacttc |
321 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| |||| ||||||||| |||||| |
|
|
| T |
4806155 |
ctcttctaataatcgttgatcttcataacttatttccaatattcagcaacttc |
4806207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University