View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_high_24 (Length: 366)
Name: NF18077_high_24
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 5e-38; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 26502510 - 26502392
Alignment:
| Q |
1 |
tgagattacgatgtcaacttgctttatgaccttaaccaaactctgatggtcgtatatatcaccctgt---caaaaaatcaacatcaattattaagactta |
97 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
26502510 |
tgagattacgatgtccacttgctttatcaccttaaccaaactctgatggtcgtatatatcaccctgtaaaaaaaaaatcaacatcaattattaagaccta |
26502411 |
T |
 |
| Q |
98 |
cc-ataaataccaaacaac |
115 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
26502410 |
ccaataaataccaaacaac |
26502392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 310 - 350
Target Start/End: Complemental strand, 26502073 - 26502033
Alignment:
| Q |
310 |
attattatctttagttattatagacttaatagtcaaaatat |
350 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26502073 |
attattatctttagttattataaacttaatagtcaaaatat |
26502033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 26502391 - 26502328
Alignment:
| Q |
149 |
aataattatgaggctataattgttggcaagaaaattgcagtcttgttcaaaagaagaaaattgt |
212 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||| || |||||||||| ||||||||||| |
|
|
| T |
26502391 |
aataattatgaggctacaattattgggaagaaaattgttgttttgttcaaaaaaagaaaattgt |
26502328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University