View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_high_26 (Length: 360)
Name: NF18077_high_26
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 18191123 - 18191242
Alignment:
| Q |
19 |
tatgaagtttagtaaacatatcgatggttcattgaattttaaaattgaaaaccgagaacatgaaaccattttagttcggttttctttgattcaatttttg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||| |||| |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18191123 |
tatgaagtttagtaaacatatcgatggttcattgaatttcaaaattggaaatcgaggacataaaaccattttagtttggttttctttgattcaatttttg |
18191222 |
T |
|
| Q |
119 |
aaccgaagcagaaaacatta |
138 |
Q |
| |
|
| | ||||||||||||||| |
|
|
| T |
18191223 |
tatctaagcagaaaacatta |
18191242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 262 - 316
Target Start/End: Original strand, 18191247 - 18191301
Alignment:
| Q |
262 |
ccacacagatcgactacattgttggtgcacataataataaaataaactaaacaat |
316 |
Q |
| |
|
||||||||||||||||||||| |||| | ||||||||||||||||| |||||||| |
|
|
| T |
18191247 |
ccacacagatcgactacattgctggtactcataataataaaataaagtaaacaat |
18191301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University