View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_high_46 (Length: 256)
Name: NF18077_high_46
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 115 - 249
Target Start/End: Original strand, 42801847 - 42801982
Alignment:
| Q |
115 |
caatacttaatgatatcgttttgctagacaatcatgaggaaatttttcgcatttcgannnnnnnn-actagtttataacatatttttataagatacttca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
42801847 |
caatacttaatgatatcgttttgctagacaatcatgaggaaatttttcgcatttcgatttttttttactagtttataacatttttttttaagatacttca |
42801946 |
T |
 |
| Q |
214 |
actaccgttttaatttataactcagatttcttctca |
249 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42801947 |
actaccgtttgaatttataactcagatttcttctca |
42801982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 116
Target Start/End: Original strand, 42801718 - 42801820
Alignment:
| Q |
14 |
aaaattacatatgacatagaatgtatctaacgaaatccgacatcagggtcattgcaaaataacacacgtccaaatttcataacaaacgagataaaagatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42801718 |
aaaattacatatgacatagaatgtatctaacgaaatccgaaatcagggtcattgcaaaattacacacgtccaaatttcataacaaacgaaataaaagatt |
42801817 |
T |
 |
| Q |
114 |
gca |
116 |
Q |
| |
|
||| |
|
|
| T |
42801818 |
gca |
42801820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University