View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_high_48 (Length: 250)
Name: NF18077_high_48
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_high_48 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 42885008 - 42884776
Alignment:
| Q |
16 |
atgggaggaaaatatacaacaagccaattgatagactctgatagagtttaaatacttttaaaaactcatttcaggcatgagcttgttgtgagatatataa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42885008 |
atgggaggaaaatatacaacaagccaattgatagactttgatagagtttaaatacttttaaaaactcatttcaggcatgagcttgttgtgagatata--a |
42884911 |
T |
|
| Q |
116 |
ttagtggatgatccggattaatagactttactattatattaagttttatattgaggataattcattcttataaaatcggttcgtaagatgatgattatta |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42884910 |
ttagtggatgatccggattgatagactttactattatattaaattttatattgagaataactcattcttataaaatcggttcgtaagatgatgattatta |
42884811 |
T |
|
| Q |
216 |
ctttttgtgcattcatttcaagttttttattattt |
250 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |
|
|
| T |
42884810 |
ctctttgtgcattcatttcaagttttttattattt |
42884776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University