View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_high_57 (Length: 216)
Name: NF18077_high_57
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_high_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 6085299 - 6085121
Alignment:
| Q |
18 |
gaaagtgatgaaacaaatgttacttttgaattctctgtttctactgtttcagcggaaggaggttataacagctttgtgacagtcacaatgaaagaatgtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
6085299 |
gaaagtgatgaaacaaatgttacttttgaattctctgtttctactgtttcagcggaaggagtttataacaactttatgacagtcacaatgaaagaatgtg |
6085200 |
T |
 |
| Q |
118 |
ggatctgcccaatttatttctcagaatttcaaatgcttttaagcatactaaatttggacaaggaatcacaattaaattt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6085199 |
ggatctgcccaatttatttctcagaatttcaaatgcttttaagcatactaaatttggacaaggaatcacaattaaattt |
6085121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 103 - 194
Target Start/End: Complemental strand, 6060273 - 6060182
Alignment:
| Q |
103 |
caatgaaagaatgtgggatctgcccaatttatttctcagaatttcaaatgcttttaagcatactaaatttggacaaggaatcacaattaaat |
194 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||| ||||||| || || ||||||||||||| |||| ||||||||||| |
|
|
| T |
6060273 |
caatgaaagagtgtgggatctgcccaatttatttgtcagaatttcatatgctttcaaccacactaaatttggacgaggacacacaattaaat |
6060182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University