View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18077_low_27 (Length: 360)

Name: NF18077_low_27
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18077_low_27
NF18077_low_27
[»] chr1 (2 HSPs)
chr1 (19-138)||(18191123-18191242)
chr1 (262-316)||(18191247-18191301)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 18191123 - 18191242
Alignment:
19 tatgaagtttagtaaacatatcgatggttcattgaattttaaaattgaaaaccgagaacatgaaaccattttagttcggttttctttgattcaatttttg 118  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||| ||| |||| |||| |||||||||||||| |||||||||||||||||||||||    
18191123 tatgaagtttagtaaacatatcgatggttcattgaatttcaaaattggaaatcgaggacataaaaccattttagtttggttttctttgattcaatttttg 18191222  T
119 aaccgaagcagaaaacatta 138  Q
     | | |||||||||||||||    
18191223 tatctaagcagaaaacatta 18191242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 262 - 316
Target Start/End: Original strand, 18191247 - 18191301
Alignment:
262 ccacacagatcgactacattgttggtgcacataataataaaataaactaaacaat 316  Q
    ||||||||||||||||||||| |||| | ||||||||||||||||| ||||||||    
18191247 ccacacagatcgactacattgctggtactcataataataaaataaagtaaacaat 18191301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University