View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_low_39 (Length: 306)
Name: NF18077_low_39
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 65 - 291
Target Start/End: Original strand, 6383311 - 6383537
Alignment:
| Q |
65 |
ttttgaattatttgttcagttggtcatgttttaacatttaggaatccgtagtagatatctaactccatgttgtttgttagcatacttttcccaaatttat |
164 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6383311 |
ttttgaataatttgttcagttggtcatgttttaacatttaggaatccgtagtagatatctaactccatgttgtttgttagcatacttttcccaaatttat |
6383410 |
T |
 |
| Q |
165 |
ctcttcttaacataaaccatgttataaattcgaatgacttataaattgtttatttttatgcttgactttaaatgaatatttagaatctctttaattttat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6383411 |
ctcttcttaacataaaccatgttataaattcgaatgacttataaattgtgtatttttatgcttgactttcaatgaatatttagaatctctttaattttat |
6383510 |
T |
 |
| Q |
265 |
agtaaaatgacattaaaatgttgattt |
291 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6383511 |
agtaaaatgacattaaaatgttgattt |
6383537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University