View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_low_44 (Length: 282)
Name: NF18077_low_44
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 17 - 123
Target Start/End: Complemental strand, 29195107 - 29195001
Alignment:
| Q |
17 |
actttttagtcgcataaaatcaaattttactttcatttttggatcaccaaagtgatttgtatatgtaccatgtcataaacaactagttgaagttttactt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29195107 |
actttttagtcgcataaaatcaaattttactttcatttttggatcaccaaagtgatttgtatatgtaccatgtcataaacaactagttgaagttttactt |
29195008 |
T |
|
| Q |
117 |
atgtgtt |
123 |
Q |
| |
|
||||||| |
|
|
| T |
29195007 |
atgtgtt |
29195001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 187 - 273
Target Start/End: Complemental strand, 29194937 - 29194851
Alignment:
| Q |
187 |
tttatctcagtgaaaaaatcatgtagtgcaatatgtattctcattgccgtccttcttttttcagattaaagatttacatttggtctc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29194937 |
tttatctcagtgaaaaaatcatgtagtgcaatatgtattctcattgccgtccttcttttttcagattaaagatttacatttggtctc |
29194851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 187 - 273
Target Start/End: Original strand, 29199107 - 29199193
Alignment:
| Q |
187 |
tttatctcagtgaaaaaatcatgtagtgcaatatgtattctcattgccgtccttcttttttcagattaaagatttacatttggtctc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29199107 |
tttatctcagtgaaaaaatcatgtagtgcaatatgtattctcattgccgtccttcttttttcagattaaagatttacatttggtctc |
29199193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University