View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_low_47 (Length: 275)
Name: NF18077_low_47
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 13 - 243
Target Start/End: Complemental strand, 37186766 - 37186541
Alignment:
| Q |
13 |
aatatttatccttgactgtgttcatacttaagtttgtggagactaagaaaagaaaataatgattcatcaagtttgttttagaaggggannnnnnnaaaca |
112 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37186766 |
aatatttatccttgaccgtgttgatacttaagtttgtggagactaagaaaagaaaataatgattcatcaagtttgttttagaaggggatttttttaaaca |
37186667 |
T |
|
| Q |
113 |
tattctattataatttatttggtaacattgtttttgtctggttgatgttgttatatttacaaatgtgtttgcattaacttattaatgaagaaatgtcatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37186666 |
tattctattataatttatttggtaacattgtttttgtctggttgatgttgttatatttacaaatgtgtttgcattaacttattaatgaagaaatgttatt |
37186567 |
T |
|
| Q |
213 |
cttatattagttataatcttagtttccatag |
243 |
Q |
| |
|
| ||||||| ||||||||||||||||| |
|
|
| T |
37186566 |
c-----ttagttacaatcttagtttccatag |
37186541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University