View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_low_5 (Length: 591)
Name: NF18077_low_5
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 1e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 484 - 561
Target Start/End: Original strand, 686599 - 686676
Alignment:
| Q |
484 |
catgtagtcaagctttcgagatggggaccaaagagattctttggatcggtacataaaaggttcattctttcctgttat |
561 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
686599 |
catgtagtcaagctttcgagatggggaccaaagagattccttggatcggtacataaaaggttcattctttcctgttat |
686676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 445 - 485
Target Start/End: Original strand, 686537 - 686577
Alignment:
| Q |
445 |
taagtggtctgaatctgaactatactcttattactcacaca |
485 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
686537 |
taagtggtctgaatctgaactatactcttattactcacaca |
686577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University