View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_low_56 (Length: 237)
Name: NF18077_low_56
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 2058131 - 2057924
Alignment:
| Q |
13 |
aatattaatagttgatgttnnnnnnncacgattaataggaatgctcgtgagtccggataacccgttcaattcaacaatccaaacaaactcaaccccatat |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2058131 |
aatattaatagttgatgttaaaaaaacacgattaataggaatgctcgtgagtccggataacccgttcaattcaacaatccaaacaaactcaaccccatat |
2058032 |
T |
 |
| Q |
113 |
tttacctgaacacatttaagtttgggtcaaacatgagccaatttgttctaaatttaaagtgaattggttttgataacaaatttatgattgcaaatccatg |
212 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2058031 |
tttacccgaacacatttaagtttaggtcaaacatgagccaatttattctaaatttaaagcgaattggttttgataacaaatttatgattgcaaatccacg |
2057932 |
T |
 |
| Q |
213 |
aacacatg |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
2057931 |
aacacatg |
2057924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University