View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18077_low_59 (Length: 227)
Name: NF18077_low_59
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18077_low_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 9400294 - 9400504
Alignment:
| Q |
1 |
aataaattgtttaaacaagctacaaatgggtttatggctttccatgttttagaaaggaataaacatattcctagatgccttgtaattataaaatgtttga |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
9400294 |
aataaattgtttaaacaagctacatatgggtttatggctttccatgttttagaaaggaataaacatattcctagatgccatgtacttataaaatgtttga |
9400393 |
T |
 |
| Q |
101 |
ggtcatatgataagctgaccctcataaatttattcaactcgtcctttttatacttacgatgcccttttactgcttttggaaccatgccagtgaatccgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9400394 |
ggtcatatgataagctgaccctcataaatttattcaactcgtcctttttatacttacgatgcccttttactgcttttggaaccatgccagtgaatccgat |
9400493 |
T |
 |
| Q |
201 |
ttggtccttta |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
9400494 |
ttggtccttta |
9400504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University