View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18078_high_42 (Length: 303)
Name: NF18078_high_42
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18078_high_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 15304991 - 15305291
Alignment:
| Q |
1 |
tttcttgtgcaggaaatacattatattagcataaaattctctcataaactcgtagtgcaactttcttggtggattcactaggacattccctttccttgat |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15304991 |
tttcttgtgtaggaaatacattatattagcataaaattctctcataaactcgtagtgcaactctcttggtggattcactaggacattccctttccttgat |
15305090 |
T |
|
| Q |
101 |
agtatcatgttggatacatgtatgcaatcacccatcgaattaaaataaaacnnnnnnnnatgcataattcttcttcttgaaagctgcacaaattgctctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15305091 |
agtatcatgttggatacatgtatgcaatcacccatcgaattaaaataaaacttttttttatgcataattcttcttcttgaaagctgcacaaattgctctt |
15305190 |
T |
|
| Q |
201 |
gctgctcaggtcctttgaatctttttgcggcatgcatcctcaaaga-----------aggcatttcatgtcttgtgatccataggcatttcatagttttg |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15305191 |
gctgctcaggtcctttgaatctttttgcggcatgcatcctcaaagaaacttgtccataggcatttcatgtcttgtgatccataggcatttcatagttttg |
15305290 |
T |
|
| Q |
290 |
a |
290 |
Q |
| |
|
| |
|
|
| T |
15305291 |
a |
15305291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University