View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18078_high_50 (Length: 271)
Name: NF18078_high_50
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18078_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 50 - 256
Target Start/End: Complemental strand, 6624980 - 6624775
Alignment:
| Q |
50 |
caagtttgtatacttaccagttacgagtaactcttaaattactcgagtaatagtttctaataaataccaatagattaccatttcactaaagcgtgtcttt |
149 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
6624980 |
caagtttttatacttaccagttacgagtgactcttaaattactcgagtaatagtttctaataaatgccaatagattaccagttcactaaagcgtgtcttt |
6624881 |
T |
 |
| Q |
150 |
tattacatttccattgcaatgcannnnnnnncttttaaaaatgtgcaatgtatatgggcacacaattctcccttttctattgattgatgcatatattcga |
249 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6624880 |
tattacattcccattgcaatgca-tttttttcttttaaaaatgtgcaatgtatatgggcacacaattctcccttttctattgattgatgcatatattcga |
6624782 |
T |
 |
| Q |
250 |
gaataat |
256 |
Q |
| |
|
||||||| |
|
|
| T |
6624781 |
gaataat |
6624775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University