View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18078_high_52 (Length: 261)
Name: NF18078_high_52
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18078_high_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 33536257 - 33536491
Alignment:
| Q |
19 |
ttgtcacgttcatttttcttgtattatatcatatttttccaattattttgatgatcataactttatgagatgatatgatgattagtttagttggtaaata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33536257 |
ttgtcacgttcatttttcttgtattatatcatatttttccaattattttgatgatcataactttatgagatgaaatgatgattagtttagttggtaaata |
33536356 |
T |
 |
| Q |
119 |
ggtaatgtgattg---ataatgccgttcatttgttagcaacgtcgtcattgtcgtacgctagcttccaaatttatgatcatatgtcatcttgtattatga |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33536357 |
ggtaatgtgattgataataatgccgttcatttgttagcaacgttgtcattgtcgtatgctagcttccaaatttatgatcatatgtcatcttatattatga |
33536456 |
T |
 |
| Q |
216 |
ccgaagatctattgtatgattgatattattatttt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33536457 |
ccgaagatctattgtatgattgatattattatttt |
33536491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 211
Target Start/End: Complemental strand, 38078237 - 38078205
Alignment:
| Q |
179 |
ttccaaatttatgatcatatgtcatcttgtatt |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
38078237 |
ttccaaattcatgatcatatgtcatcttgtatt |
38078205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University