View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18078_high_56 (Length: 250)
Name: NF18078_high_56
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18078_high_56 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 35 - 250
Target Start/End: Complemental strand, 43338348 - 43338130
Alignment:
| Q |
35 |
gcataattgatttatatattcaaaataaagagtggtacgcca---atgttgtgtttcattaatttgtcgagcttttacaattctgaatttgtaaaaagca |
131 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43338348 |
gcataatcgatttatatattcaaaataaagattggtacgccattaatgttgtgtttcattaatttgtcgagcttttacaattctgaatttgtaaaaagca |
43338249 |
T |
|
| Q |
132 |
gtaaaatatgagaatcatcaataaagagataatctgagctccaaatctagctcttgagtgtcacttgattctgaacccatggaactactcctcttcttca |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43338248 |
gtaaaatatgagaatcatcaataaagagataatctgagctccaaatctagctcttgagtgtcacttgattctgaacccatggaactactcctcttcttca |
43338149 |
T |
|
| Q |
232 |
tatctatgttttgagagtc |
250 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43338148 |
tatctatgttttgagagtc |
43338130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University