View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18078_low_48 (Length: 285)
Name: NF18078_low_48
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18078_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 130 - 262
Target Start/End: Complemental strand, 48516964 - 48516832
Alignment:
| Q |
130 |
cttaatctacgatccatattggagaagactggaaagtgcgtttgaattgatctattcttaagaaataaaatgtgtgtactatgtcttaatatttatgcta |
229 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |||| |
|
|
| T |
48516964 |
cttaatcaatgatccatattggagaagactggaaagtgcgtttgaattgatctattcttaagaaataaaatgtttgtactgtgtcttaatatttacgcta |
48516865 |
T |
 |
| Q |
230 |
tccaaatccaagtcagtggtctaaggtaaactc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48516864 |
tccaaatccaagtcagtggtctaaggtaaactc |
48516832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 19 - 127
Target Start/End: Complemental strand, 48517108 - 48516999
Alignment:
| Q |
19 |
atcacctaacaaattattttaattttgttgcaatggctaaaagtcattnnnnnnnn-ttgaaactttgtgttaatacaataaaagatttctgtaactata |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48517108 |
atcatctaacaaattattttaattttgttgcaatggctaaaagtcattcaaaaaaaattgaaactttgtgttaatacaataaaagatttctgtaactata |
48517009 |
T |
 |
| Q |
118 |
aaagcatgcc |
127 |
Q |
| |
|
|||||||||| |
|
|
| T |
48517008 |
aaagcatgcc |
48516999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University