View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18078_low_55 (Length: 258)
Name: NF18078_low_55
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18078_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 44016779 - 44017010
Alignment:
| Q |
19 |
agagttgaccaaaagaaggtgggatagagccagagagattggttgaagagagattaagaagctgaagcattgttaaagaggatagttgagatggtaaaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44016779 |
agagttgaccaaaagaaggtgggatagagccagagagattggttgaagagagattaagaagctgaagcattgttaaagaggatagttgagatggtaaaga |
44016878 |
T |
 |
| Q |
119 |
agtgaggttgaggaaagtatcagggatagaaagggaaatcactctagattgtggtgaacaagttatgcctttccatgaacatggtgttgatgttgaaggg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44016879 |
agtgaggttgaggaaagtatcagggatagaaagggaaatcactctagattgtggtgaacaagttatgcctttccatgaacatggtgttgatgttgaaggg |
44016978 |
T |
 |
| Q |
219 |
ttccatgaagagagaatagaaggtgatgatgt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44016979 |
ttccatgaagagagaatagaaggtgatgatgt |
44017010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University