View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18078_low_65 (Length: 226)
Name: NF18078_low_65
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18078_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 210
Target Start/End: Original strand, 4885203 - 4885401
Alignment:
| Q |
12 |
agcatagggagggacaacaacgatcttaggaacaactccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatg |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885203 |
agcatcgggagggacaacaacgatcttaggaacaacaccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatg |
4885302 |
T |
|
| Q |
112 |
atttcacttgctttgatgctgccactgatttcttctactcgaccgttgcagtgtactatacggatcacatcaagtgctccacatggtagaatgcaagat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885303 |
atttcacttgctttgatgctgccactgatttcttctactcgaccgttgcagtgtactatacggatcacatcaagtgctccacatggtagaatgcaagat |
4885401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University