View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18078_low_72 (Length: 209)
Name: NF18078_low_72
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18078_low_72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 11 - 192
Target Start/End: Complemental strand, 10320408 - 10320230
Alignment:
| Q |
11 |
gaagaaaatgcattttggttgttatgatggaagtctttagttgagttgtacttagaattaataatgctcaagcttgaaagctttcaagagtaattattac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
10320408 |
gaagaaaatgcattttggttgttatgatggaagtctttagttgagttgtacttagaattaat---gctcaagcttgaaagcttccaagagtaattattac |
10320312 |
T |
|
| Q |
111 |
tagtaaatagggaagggacaagtggaatacataatttaccatactaaagtcttgtttacttggtgaattgggcagtgcttgg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10320311 |
tagtaaatagggaagggacaagtggaatacataatttaccatactaaagtcttgtttacttggtgaattgggcagtgcttgg |
10320230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University