View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18078_low_73 (Length: 209)
Name: NF18078_low_73
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18078_low_73 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 5e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 46 - 196
Target Start/End: Original strand, 28292639 - 28292789
Alignment:
| Q |
46 |
gtttcttattgtttcaagcaactacaatccaaaagttcaaatgcattttgggtttaatttatgggtttgatgcatatactcagaaacccaaaaataatta |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28292639 |
gtttcttattgtttcaagcaactacaatccaaaagttcaaatgcattttgggtttaatttatgggtttgatgcatatactcagaaacccaaaaataatta |
28292738 |
T |
 |
| Q |
146 |
gagaagaagttgttgatgnnnnnnnnttgtaactatcatttctttcttctc |
196 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28292739 |
tagaagaaattgttgatgaaaaaaaattgtaactatcatttctttcttctc |
28292789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 28291792 - 28291842
Alignment:
| Q |
1 |
gcttctttcacctttatcttggtttttgtttcttgcatctttatcgtttct |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28291792 |
gcttctttcacctttatcttggtttttgtttcttgcatctttatcgtttct |
28291842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University